"терминал-уведомитель.приложение больше не работает"

Как я упоминал в Что сделать все картинки на передней части "Unix и Linux системное администрирование справочника" представляете? Я довольно новыми для Linux и Unix.

@jasonwryan дали отличную ссылку на блог, который описывает все предметы на фронте Первой книги, но есть ли объяснение для всех элементов на обложке "справочника администрирование Linux"? Я не видел другие записи в блоге Лиза Хэнли.

Cover

  1. Облако
  2. Пингвин Катание На Лыжах
  3. Вертолет Виста
  4. Надгробие
  5. Гроб
  6. Книга
  7. Мертвая Кошка
  8. Мальчик в кубе
  9. Обезьяна на лиане
  10. Автошины
  11. Сдержанная Паук
  12. Скалы
  13. Спок
  14. Руки
  15. Врач
  16. Тоннель
+695
centr0 23 дек. 2021 г., 23:04:48
17 ответов

Я искал в интернете и, видимо, этот процесс как-то связано с iCloud диск! У меня нет больше 10 МБ, все данные и документы в iCloud езды; но этот процесс использует больше чем 300 Мб каждый раз, когда это начинается. Это обычно начинается в течение перезагрузка компьютера. Я также проверил настройки в iCloud Drive на iPhone и отключены все резервные копии данных и прочее для приложений (даже WhatsApp и другие, которые даже не на моем Mac). Я понятия не имею, что вызывает эту Хуг пропускной способности. Все фотографии облаке материал был выключен. Я не пользуюсь сафари, и через хром.

Так что именно происходит? Единственный способ исправить это, выключая всего iCloud диск вещь? Это ошибка? Я использую Йосемити 10.10

Мне нравится использовать iCloud диск для синхронизации все страницы и номера документов между iPhone и Mac (которые в совокупности не более чем 10 МБС).

enter image description here

enter image description here

+972
Fingolfin 03 февр. '09 в 4:24

См. также ГНУ источник-изюминка, которая поддерживает множество языков ввода и несколько выходных форматов.

+950
Arty Roger 2 мар. 2016 г., 15:09:08
Другие ответы

Связанные вопросы


Похожие вопросы

Имеют длительный процесс (несколько месяцев), который обрабатывает огромное количество связей и делает работу, но большинство статистики показывают, он делает ноль работы. Вот выход трассированием, показывая кучу системных вызовов, но 0 процессорного времени:

% времени секунд usecs/звонков ошибки системного вызова
------ ----------- ----------- --------- --------- ----------------
 0.000000 0.00 0 66376 писать
 0.000000 0.00 0 27579 закрыть
 0.000000 0.00 0 77 стат
 0.000000 0.00 0 46 гнездо
 0.000000 0.00 0 46 подключение
 0.000000 0.00 0 21360 347 принимать
 0.000000 0.00 0 140039 отправить
 0.000000 0.00 0 169718 21567 вызов recvfrom
 0.000000 0.00 0 21013 getsockname
 0.000000 0.00 0 21013 getpeername
 0.000000 0.00 0 42026 помощью
 0.000000 0.00 0 46 вызове
 0.000000 0.00 0 63177 вызова fcntl
 0.000000 0.00 0 68858 gettimeofday
 0.000000 0.00 0 1861 системах
 0.000000 0.00 0 620 вызов epoll_wait
 0.000000 0.00 0 96667 epoll_ctl
------ ----------- ----------- --------- --------- ----------------
100.00 0.000000 740522 21914 общая

В партнеров и в стиме поля для этого процесса не равен нулю, но абсолютно статично, и не у любого инт переполнения ограничения, которые я признаю:

$ у awk '{печати "партнеров:" 14$, "чтимы:" $15}' /proc и/128618/стат
партнеров:78891786 чтимы:403631467

Что странно, я вижу этот же симптом на ряд других коробок, с такой же процесс. Это все работает на ядре 3.13.0. Этот процесс является однопоточным, и не делаешь ничего сверхъестественного (pgbouncer).

Почему процесс продолжать делать работу, не имея какой-либо из эти статистические данные отражают, что работы происходят?

+851
Znayushaya 17 февр. 2016 г., 09:07:14

Предыдущий ответ по-прежнему работает, а также для Yosemite/Эль Капитано/Sierra с оговоркой, что система защиты целостности (СИП) теперь должна быть отключена.

  1. Проверить текущую длительность слайдов:

    суда /usr/IP-адресов/PlistBuddy -с "печати ':JustASlide:mainDuration'" /System/Library/PrivateFrameworks/Slideshows.framework/Versions/A/Resources/Content/EffectDescriptions.plist
    

    Системное значение по умолчанию-3.

  2. Перезагрузите компьютер и удерживайте команду cmd+R на выздоровление. В меню выберите Служебные программы > терминал и отключить СИП с помощью следующей команды:

    csrutil отключить
    
  3. Снова перезагрузите компьютер и настройте длительность слайдов на нужное значение в секундах:

    суда /usr/IP-адресов/PlistBuddy -с "Набор ':JustASlide:mainDuration' 10" /System/Library/PrivateFrameworks/Slideshows.framework/Versions/A/Resources/Content/EffectDescriptions.plist
    
  4. Перезагрузите еще раз в Recovery (УМК+Р) и включить SIP для хорошей мерой

    csrutil включить
    
+811
Pablo Leon 16 июн. 2014 г., 02:59:01

К сожалению, мой веб-хостинг плана не позволяет аутентификации по публичному ключу. Видимо, этот метод доступен для VPS и выделенных серверов клиентов только.

Это машина с Ubuntu 11.10, используя в deja-DUP и я посылаю файлов резервное копирование на моем веб-узла с помощью rsync.

Я хотел бы автоматизировать этот процесс с помощью скрипта, но как я не в состоянии использовать открытый ключ аутентификации, я вынужден вручную скопировать и вставить мой (сильный) СШ пароль каждый раз, чтобы начать процесс.

Есть путь вокруг этого? Если да, то как?

+800
santhosh kotha 27 окт. 2011 г., 06:52:16

Мой брат только что приземлился в США в Ньюарке и сказали, что там были отдельные очереди-одна для тех, кто въехал в США в течение последних двух лет на ЭСТА и другие для первых посетителей время. Почему такое разделение на месте?

+730
user60434 20 апр. 2015 г., 13:44:20

Использовать загрузчик GRUB-установить (скорее всего, без дополнительных аргументов), чтобы добавить новую запись; испытайте, что это загрузочный; использование в программе efibootmgr -Б удалить старые записи (без аргументов во-первых, чтобы найти bootnum); штанга Смита статей значительно рекомендуется.

Позорный разъем: вы можете найти мой образ восстановления полезно на случай, если что-то пойдет не так.

+667
user54546 17 апр. 2013 г., 19:10:26

Конечно, она должна мочиться на день раньше? Если предположить, что вет не обязательно сегодня ПОО (только самые последние ПОО), начать экономить ложки накануне, и заменить предыдущие совок с последней совок, как ты приехать.

+388
Jerryonest 16 дек. 2017 г., 13:11:27

Я читал похожий пример из книги программирование на bash:

$ кот косвенности 
#!/usr/Бен/ОКР Баш

комплект -х
Нум=1
функция eval "${!Нум#*:}"
$ 

Когда я выполнить скрипт с Баша косвенности "тест:Эхо-бла", тогда как в последней строке скрипта обрабатывается? Я думаю, сначала абстрагирование происходит так, что функция eval "${!Нум#*:}" будет использовать eval "${1#*:}"? Затем подстроки, удаление и функция eval "${1#*:}" становится ивала Эхо бла? Если да, то почему ивала нужно, я.е ${!Нум#*:} вместо того, чтобы использовать eval "${!Нум#*:}" обеспечит такие же результаты?

+348
Thomas KUNTZ 22 мар. 2021 г., 13:01:55

Мое текущее решение, для справки:

Единственный способ, который я смог получить дисплей будет на этой машине был:

  • игнор - нуво
  • добавить в предыдущем стабильном выпуске репозитории источников.список
  • apt-получить удалить весь файл xorg подсистемы (и ГРМ)
  • apt-получить -Т старого стабильного дистрибутива установки предыдущей версии xorg из подсистемы (включая НВ водителя) и xfce4

(Я использую xfce4 учитывая возраст оборудования)

iMac G4 running Debian 7.7 and xfce4

Х запускается, загружает драйвер NV и ... теперь у меня есть Гуй.

Это немного компромисс, но, по крайней мере, части операционной системы до-до-даты.

+313
Avinash Bunde 19 дек. 2020 г., 21:21:06

Я применяю помидорного во время работы (Работа за компьютером/постоянной регистрации). То есть, один работает 25 минут и занимает 5' перерыв. Смыть, повторить.

Бы это быть здоровым/безопасно делать упражнения с умеренными весами, такие как приседания или становая тяга в течение этих 5 минут без разминки?

Намерение-это просто насос крови и ввести некоторые регулярные физические нагрузки в течение дня.

+302
Falkenad 23 окт. 2014 г., 08:55:52

Мой друг, который делал неполный рабочий день для французского правительства, был призван, чтобы помочь интервью ищущих убежища из Северной Кореи. Оказывается, они были не из Кореи, на север или на юг: они были китайцами, и не сказать ни слова по-корейски. Мой друг, который, случается слишком говорить по-китайски, узнал, что они были носителями китайского, скорее всего, от Дунбэй.

Они уничтожили свои китайские паспорта после прибытия во Францию, заявив, что уничтожил их северокорейские паспорта, чтобы их не отправили обратно. Излишне говорить, что их убежище было отказано...

+277
Ijeoma M 10 окт. 2022 г., 16:26:08

Не очень точно, потому что это зависит от того, что вы считаете узла. Хозяин еще более непонятно.

  • Это только полные узлы?
  • Она включает свет клиентов?
  • Какой минимальный уровень проверки должен это делать?
  • Должно быть, прислушиваясь к сверстникам?

Веб-сайты, такие как bitnodes.Ио предоставить ряд слушая узлов, но это не обязательно гарантирует, что они действуют как таковые, или делать какие-либо операции по проверке:

Bitnodes в настоящее время разрабатывается, чтобы оценить размер Сеть Bitcoin, находя все достижимые узлы в сети. В существующая методика предполагает отправку сообщения getaddr рекурсивно найти все достижимые узлы в сети, начиная от набора узлы семян. Bitnodes использует протокол Биткоин версия 70001 (т. е. >= /Сатоши:0.8.х/), поэтому узлы используете старую версию протокола будет пропущен. Реализация обходчика в Python доступен на сайте GitHub (ayeowch/bitnodes) и развертывание гусеничный описана в Подготовка Сети Bitcoin Обходчика.

+179
Joshua Abenazer 28 июл. 2017 г., 15:05:11

Как только я захожу в интернет через мой переносной точки доступа 3G, все программы радостно начинает тянуть обновления (например, Gwibber, Тандерберд, обновить менеджер...) и есть в моей квоты трафика. Есть ли способ, чтобы активировать подключение к сети, но только сказать об этом конкретные программы (например, Firefox, если я просто хочу, чтобы быстро отыскать что-нибудь)? Обратите внимание, что я не ищу для ограничения пропускной способности, я просто хочу предотвратить автоматическую "Ой, я онлайн, давайте получить некоторые данные" поведения.

Редактировать: я уже получил две полезные ответы, однако, я все еще хотел бы добавить некоторые уточнения: что NetworkManager не рассказать запущенных программ, они теперь онлайн? Я предполагаю, что это какая-то ДГУ сообщение. Я могу допустить, что с отправкой?

+167
dasha191098 1 февр. 2013 г., 18:55:54

Ни один из инструментов, упомянутых вами будет делать это автоматически, потому что они все полагаются на кого-то, сопровождающего пакет, для обновления пакета текущим новых релизов. Единственным исключением из этого является СКВ PKGBUILDs, где они будут, по умолчанию, вытащить последний источник.

Помощники srcinfo ОЗМ читать, чтобы определить, если пакет был обновлен. Нет никакой магии в работе, кто-то еще должен сделать, что и любые другие необходимые изменения пакета текущим, чтобы вызвать восстановление/обновление.

Вы можете написать скрипт для обновления пакета текущим, но эффективно предположим, сопровождающий роль, так, как вам этого добиться, вам придется обновить пакета текущим.

+103
user251752 22 сент. 2010 г., 20:12:44

Если вы можете установить Экспоузд Framework, попробуйте модуль Настройки Приложения , который позволяет кормить каждого приложения свои специфические параметры (включая ориентацию).

+65
Hector Ordonez 21 июл. 2014 г., 09:04:23

У меня есть файл fasta (сл.FA), который является стандартным форматом файла для генетическая информация, например, так:

>ТР1|c0_g1_i1
GTCGAGCATGGTCTTGGTCATCTTCCTTTCAAAGAA
>О TR6|c0_g1_i1
GTGGAATATCGCCAGTGACCATCACTGATTAACCTG

У меня тоже есть файл с именами, совпадающими заголовками (">ТР..." имена):

ТР1|c0_g1_i1 scaf0432344_50037.734_wgs
О TR6|c0_g1_i1 scaf0159424_10142.072_wgs

Мне нужно сделать "scaf0..." идентификаторы первое, что приходит после того, как файл ">" в сл.ФА.

Я хочу, чтобы держать "ТР..." идентификаторы, которые являются уникальными для каждого из моих последовательностей, например:

>scaf0432344_50037.734_wgs|ТР1|c0_g1_i1
GTCGAGCATGGTCTTGGTCATCTTCCTTTCAAAGAA
>scaf0159424_10142.072_wgs|о TR6|c0_g1_i1
GTGGAATATCGCCAGTGACCATCACTGATTAACCTG

Имена файлов в том же порядке, в последовательности файл!

Не пробовал ничего, так как я не обучен и не имеешь понятия, что я делаю :/

+16
Chando Nave 30 янв. 2014 г., 20:59:47

Показать вопросы с тегом